|
Left Crispr |
Right Crispr |
| Crispr ID |
945495964 |
945495966 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:210507155-210507177
|
2:210507176-210507198
|
| Sequence |
CCTATCAGACTAACAATGGATCT |
CTCTCGGCAGAAACTCTAGAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 20, 1: 1156, 2: 3412, 3: 4262, 4: 2567} |
{0: 1, 1: 7, 2: 23, 3: 38, 4: 141} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|