ID: 945565986_945565992

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 945565986 945565992
Species Human (GRCh38) Human (GRCh38)
Location 2:211400154-211400176 2:211400199-211400221
Sequence CCTTAAAAAAGTGTTCTCTAAGC GGGGATAATAATGCCTGTGTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 21, 4: 176} {0: 1, 1: 0, 2: 1, 3: 22, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!