ID: 945578774_945578781

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 945578774 945578781
Species Human (GRCh38) Human (GRCh38)
Location 2:211566022-211566044 2:211566068-211566090
Sequence CCACCAGGACTGCAACAAGATGA TTGAGGCGTCACGCCTAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 219} {0: 1, 1: 0, 2: 0, 3: 2, 4: 25}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!