ID: 945586045_945586051

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 945586045 945586051
Species Human (GRCh38) Human (GRCh38)
Location 2:211664402-211664424 2:211664430-211664452
Sequence CCTATAGGCATTCACAATGGAGA CTTTATGGGCAGTAGGAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 107} {0: 1, 1: 1, 2: 2, 3: 34, 4: 310}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!