ID: 945588115_945588119

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 945588115 945588119
Species Human (GRCh38) Human (GRCh38)
Location 2:211692676-211692698 2:211692718-211692740
Sequence CCCTCTACCTTCCTCTTATAAAG TAACCCACTCAAATAACTTTAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 26, 3: 174, 4: 578} {0: 1, 1: 0, 2: 0, 3: 11, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!