ID: 945636645_945636649

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 945636645 945636649
Species Human (GRCh38) Human (GRCh38)
Location 2:212361743-212361765 2:212361790-212361812
Sequence CCTCCACAATCCTCAACTGATTC ATTCGACAATGTCTGGCATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 217} {0: 1, 1: 0, 2: 1, 3: 9, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!