|
Left Crispr |
Right Crispr |
| Crispr ID |
945637188 |
945637194 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:212370099-212370121
|
2:212370123-212370145
|
| Sequence |
CCTGTCAAGGGCAGGTCCAGGTA |
AGATAATTGAATCATGGGGGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 15, 3: 27, 4: 166} |
{0: 716, 1: 2489, 2: 3822, 3: 4761, 4: 5158} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|