ID: 945637188_945637196

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 945637188 945637196
Species Human (GRCh38) Human (GRCh38)
Location 2:212370099-212370121 2:212370149-212370171
Sequence CCTGTCAAGGGCAGGTCCAGGTA CCTCCATGCTGTTCTCAGAATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 15, 3: 27, 4: 166} {0: 1, 1: 3, 2: 22, 3: 96, 4: 467}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!