ID: 945674008_945674015

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 945674008 945674015
Species Human (GRCh38) Human (GRCh38)
Location 2:212833318-212833340 2:212833357-212833379
Sequence CCGCACACGCACACACAGAGGGG GACTCAGTAGTAGCCAGACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 93, 4: 595} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!