ID: 945703177_945703181

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 945703177 945703181
Species Human (GRCh38) Human (GRCh38)
Location 2:213197513-213197535 2:213197532-213197554
Sequence CCAAGGAGCAAGCACTAGGACAG ACAGGGAAGCAAAATGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 166} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!