ID: 945716217_945716222

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 945716217 945716222
Species Human (GRCh38) Human (GRCh38)
Location 2:213360509-213360531 2:213360546-213360568
Sequence CCTGTCAGCTCTCCAGGTGTGTC CAAGGTTACCACTTAAAGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 143} {0: 1, 1: 0, 2: 0, 3: 10, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!