ID: 945742905_945742912

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 945742905 945742912
Species Human (GRCh38) Human (GRCh38)
Location 2:213685277-213685299 2:213685301-213685323
Sequence CCCCAATCCAATATGACGCGTGT CTTGTAAGAAGGAGAAAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 35, 3: 473, 4: 1366} {0: 1, 1: 0, 2: 1, 3: 35, 4: 398}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!