ID: 945742906_945742912

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 945742906 945742912
Species Human (GRCh38) Human (GRCh38)
Location 2:213685278-213685300 2:213685301-213685323
Sequence CCCAATCCAATATGACGCGTGTT CTTGTAAGAAGGAGAAAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 67, 3: 525, 4: 1396} {0: 1, 1: 0, 2: 1, 3: 35, 4: 398}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!