ID: 945749285_945749290

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 945749285 945749290
Species Human (GRCh38) Human (GRCh38)
Location 2:213760785-213760807 2:213760818-213760840
Sequence CCTCACAGTTTTGGAGGATGAGG CATGGTGCCAACATTTGGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 21, 3: 763, 4: 14576} {0: 1, 1: 2, 2: 18, 3: 50, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!