ID: 945749747_945749752

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 945749747 945749752
Species Human (GRCh38) Human (GRCh38)
Location 2:213766853-213766875 2:213766886-213766908
Sequence CCTGCAGCTTCCTTTCAACACTG CCTGAGCACAAAGTCTGGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 258} {0: 1, 1: 0, 2: 2, 3: 12, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!