ID: 945749747_945749753

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 945749747 945749753
Species Human (GRCh38) Human (GRCh38)
Location 2:213766853-213766875 2:213766891-213766913
Sequence CCTGCAGCTTCCTTTCAACACTG GCACAAAGTCTGGGTTGGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 258} {0: 1, 1: 0, 2: 0, 3: 14, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!