ID: 945764027_945764031

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 945764027 945764031
Species Human (GRCh38) Human (GRCh38)
Location 2:213950867-213950889 2:213950902-213950924
Sequence CCCTGCTAATTTTGGGGGACCTT AGTGTCTCTCTATGTTGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 192} {0: 12, 1: 489, 2: 7629, 3: 48083, 4: 136036}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!