|
Left Crispr |
Right Crispr |
| Crispr ID |
945770399 |
945770414 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:214035292-214035314
|
2:214035338-214035360
|
| Sequence |
CCCCCAGGCTTCAGGCCCTCCCC |
GGGACCTGCCCCTTATGCCCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 7, 1: 35, 2: 158, 3: 353, 4: 832} |
{0: 1, 1: 1, 2: 3, 3: 24, 4: 179} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|