ID: 945770410_945770414

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 945770410 945770414
Species Human (GRCh38) Human (GRCh38)
Location 2:214035313-214035335 2:214035338-214035360
Sequence CCAGCTCACAGGTGGGACTTCAC GGGACCTGCCCCTTATGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 150} {0: 1, 1: 1, 2: 3, 3: 24, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!