ID: 945787871_945787875

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 945787871 945787875
Species Human (GRCh38) Human (GRCh38)
Location 2:214266138-214266160 2:214266189-214266211
Sequence CCTTATCTATGAGTGTCTTTGTA TGAAAACTAGGGTAGCGAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 293} {0: 1, 1: 0, 2: 0, 3: 6, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!