ID: 945800801_945800808

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 945800801 945800808
Species Human (GRCh38) Human (GRCh38)
Location 2:214427899-214427921 2:214427947-214427969
Sequence CCATCCATTTCCTTTCCAATACA ATCCATGGATATGAAACCCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 83, 4: 1076} {0: 1, 1: 14, 2: 49, 3: 153, 4: 472}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!