ID: 945805658_945805660

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 945805658 945805660
Species Human (GRCh38) Human (GRCh38)
Location 2:214487035-214487057 2:214487081-214487103
Sequence CCTATAAGAAGAGATTAGGACAG TTCCATGTGAAGACAGAGGAAGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 6, 3: 31, 4: 303} {0: 1, 1: 1, 2: 11, 3: 75, 4: 483}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!