ID: 945813273_945813277

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 945813273 945813277
Species Human (GRCh38) Human (GRCh38)
Location 2:214573672-214573694 2:214573703-214573725
Sequence CCTCAGTTCTGAGTCCAGAACAA TTTAGTGTTGAATTTTCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 277} {0: 1, 1: 0, 2: 2, 3: 28, 4: 337}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!