ID: 945827173_945827180

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 945827173 945827180
Species Human (GRCh38) Human (GRCh38)
Location 2:214736398-214736420 2:214736442-214736464
Sequence CCTTCCCAAATCTCCTTCCCAAT ATTGTATCTTTAACTGCATATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 70, 4: 843} {0: 1, 1: 0, 2: 1, 3: 20, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!