ID: 945850397_945850400

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 945850397 945850400
Species Human (GRCh38) Human (GRCh38)
Location 2:214999271-214999293 2:214999314-214999336
Sequence CCTGTAATGTTTCTTCCAAGTGA CTAGTATAAAGCAGAAATGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 280} {0: 1, 1: 0, 2: 1, 3: 29, 4: 234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!