ID: 945851254_945851258

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 945851254 945851258
Species Human (GRCh38) Human (GRCh38)
Location 2:215010422-215010444 2:215010452-215010474
Sequence CCAGCGGGCATGTTAATGATGTC AGGGAGAAGCAAAATGGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 35} {0: 1, 1: 0, 2: 2, 3: 24, 4: 376}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!