ID: 945858876_945858878

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 945858876 945858878
Species Human (GRCh38) Human (GRCh38)
Location 2:215098095-215098117 2:215098112-215098134
Sequence CCATGTTAGAGCTGTGTAGAGAG AGAGAGGTGTATGAGAGTTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 106} {0: 1, 1: 0, 2: 0, 3: 13, 4: 242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!