ID: 945884695_945884705

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 945884695 945884705
Species Human (GRCh38) Human (GRCh38)
Location 2:215362865-215362887 2:215362916-215362938
Sequence CCAGTGCATGGGAAGGCACGCGG GGAGCAGCCCCTGAAGCCGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 59, 4: 161} {0: 1, 1: 0, 2: 1, 3: 28, 4: 341}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!