ID: 945918287_945918295 |
View in Genome Browser |
Spacer: 23 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 945918287 | 945918295 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 2:215727988-215728010 | 2:215728034-215728056 |
Sequence | CCTATTTACCCAGAGATGAGCAA | CACAGATGTGGTTTTAGGTCAGG |
Strand | - | + |
Off-target summary | No data | {0: 1, 1: 0, 2: 0, 3: 15, 4: 193} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |