ID: 946021909_946021923

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 946021909 946021923
Species Human (GRCh38) Human (GRCh38)
Location 2:216646183-216646205 2:216646226-216646248
Sequence CCTGGAATATCTGAGAGCAGAGT CAGTGGAAGGGGAGGGTGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 202} {0: 1, 1: 0, 2: 6, 3: 92, 4: 847}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!