ID: 946027982_946027990

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 946027982 946027990
Species Human (GRCh38) Human (GRCh38)
Location 2:216683649-216683671 2:216683672-216683694
Sequence CCCCGCCCATGAGATGCTGTTCT GAGAGGTTTTTGCAGAGGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 130} {0: 1, 1: 0, 2: 1, 3: 24, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!