ID: 946029482_946029492

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 946029482 946029492
Species Human (GRCh38) Human (GRCh38)
Location 2:216693388-216693410 2:216693423-216693445
Sequence CCTCATGCACTTAATCCACACCC GTTTAAGAGATTGGGGAGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 112} {0: 1, 1: 0, 2: 3, 3: 40, 4: 449}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!