ID: 946099677_946099682

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 946099677 946099682
Species Human (GRCh38) Human (GRCh38)
Location 2:217309234-217309256 2:217309255-217309277
Sequence CCGCTCACCACCTGCTGTGCAGC GCCTGGTTCCTAACTGGTACTGG
Strand - +
Off-target summary {0: 3, 1: 245, 2: 498, 3: 808, 4: 950} {0: 1, 1: 0, 2: 4, 3: 47, 4: 415}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!