ID: 946100205_946100214

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 946100205 946100214
Species Human (GRCh38) Human (GRCh38)
Location 2:217314119-217314141 2:217314166-217314188
Sequence CCAGCCCCCTTCCTCTTGTTCTG TGCTCTACTCCACCCATAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 56, 4: 645} {0: 1, 1: 0, 2: 1, 3: 10, 4: 71}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!