ID: 946129395_946129403

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 946129395 946129403
Species Human (GRCh38) Human (GRCh38)
Location 2:217594097-217594119 2:217594122-217594144
Sequence CCAAGGACTCAGCTTCTATTTCT TAGGGGATAAGAAGGGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 378} {0: 1, 1: 0, 2: 2, 3: 91, 4: 1047}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!