ID: 946132460_946132470

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 946132460 946132470
Species Human (GRCh38) Human (GRCh38)
Location 2:217617614-217617636 2:217617645-217617667
Sequence CCCCCAGGACTCCTGCCTCAGGA CTGGGTATTAAGACCAGACCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 14, 3: 61, 4: 392} {0: 1, 1: 0, 2: 0, 3: 5, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!