ID: 946132946_946132956

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 946132946 946132956
Species Human (GRCh38) Human (GRCh38)
Location 2:217621825-217621847 2:217621877-217621899
Sequence CCCTGTGTTCTACTCTTTGAAAG CTGTAAATGCAGTGGAAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 306} {0: 1, 1: 0, 2: 1, 3: 25, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!