ID: 946133889_946133894

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 946133889 946133894
Species Human (GRCh38) Human (GRCh38)
Location 2:217629514-217629536 2:217629544-217629566
Sequence CCCCACAGAGCAGGAGCTGGGCT GGCCTCTAGCATGCCTGCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 59, 4: 380} {0: 1, 1: 0, 2: 1, 3: 10, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!