ID: 946138439_946138445

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 946138439 946138445
Species Human (GRCh38) Human (GRCh38)
Location 2:217667405-217667427 2:217667444-217667466
Sequence CCAAAGAAAAGAAAATGTTTATT AACAAGAAGGTGGGGACAAAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 9, 3: 160, 4: 1426} {0: 1, 1: 0, 2: 2, 3: 36, 4: 357}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!