ID: 946163541_946163556

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 946163541 946163556
Species Human (GRCh38) Human (GRCh38)
Location 2:217850064-217850086 2:217850108-217850130
Sequence CCTACCCCTCCACCAGCAAGCTC CAGGAAAGGGACGCGGGTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 480} {0: 1, 1: 0, 2: 1, 3: 7, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!