ID: 946166827_946166831

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 946166827 946166831
Species Human (GRCh38) Human (GRCh38)
Location 2:217869550-217869572 2:217869571-217869593
Sequence CCTGCGTGGGACTCTGAGTGGCC CCTGATGGAGTCTCCCCAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 140} {0: 1, 1: 0, 2: 1, 3: 13, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!