ID: 946166987_946166999

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 946166987 946166999
Species Human (GRCh38) Human (GRCh38)
Location 2:217870307-217870329 2:217870356-217870378
Sequence CCCAGGGCTTACACAGTGCCCAC CTGGAAACAGAAAGGAAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 182} {0: 1, 1: 1, 2: 19, 3: 237, 4: 2218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!