ID: 946176121_946176137

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 946176121 946176137
Species Human (GRCh38) Human (GRCh38)
Location 2:217922807-217922829 2:217922857-217922879
Sequence CCTTGGTGCCCCCTCGTGGCCTG CGCCCACAGCCGTGCATTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 229} {0: 1, 1: 0, 2: 0, 3: 3, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!