ID: 946185500_946185514

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 946185500 946185514
Species Human (GRCh38) Human (GRCh38)
Location 2:217978566-217978588 2:217978599-217978621
Sequence CCCCTGCCCCCGCCCCCGGGCCT CTTGACCTGCGCCCGCTCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 22, 3: 238, 4: 1961} {0: 1, 1: 0, 2: 0, 3: 23, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!