ID: 946185960_946185967

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 946185960 946185967
Species Human (GRCh38) Human (GRCh38)
Location 2:217980437-217980459 2:217980452-217980474
Sequence CCCTTTGTTGGTCCAACAGTGTG ACAGTGTGGGCTCCTTCCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 100} {0: 1, 1: 0, 2: 2, 3: 18, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!