ID: 946188014_946188023

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 946188014 946188023
Species Human (GRCh38) Human (GRCh38)
Location 2:217992150-217992172 2:217992169-217992191
Sequence CCCCACAGAAAGCATCCCCTGCC TGCCCCAGGCACTCACCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 261} {0: 1, 1: 0, 2: 4, 3: 36, 4: 349}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!