|
Left Crispr |
Right Crispr |
Crispr ID |
946197404 |
946197407 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
2:218043323-218043345
|
2:218043351-218043373
|
Sequence |
CCTCTCTGCAGCTGGTCATCCAG |
TGCAGCTCTCAACAGAAAGGAGG |
Strand |
- |
+ |
Off-target summary |
{0: 5, 1: 54, 2: 137, 3: 274, 4: 515} |
{0: 1, 1: 3, 2: 97, 3: 180, 4: 341} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|