ID: 946197404_946197407

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 946197404 946197407
Species Human (GRCh38) Human (GRCh38)
Location 2:218043323-218043345 2:218043351-218043373
Sequence CCTCTCTGCAGCTGGTCATCCAG TGCAGCTCTCAACAGAAAGGAGG
Strand - +
Off-target summary {0: 5, 1: 54, 2: 137, 3: 274, 4: 515} {0: 1, 1: 3, 2: 97, 3: 180, 4: 341}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!