|
Left Crispr |
Right Crispr |
| Crispr ID |
946197404 |
946197408 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:218043323-218043345
|
2:218043357-218043379
|
| Sequence |
CCTCTCTGCAGCTGGTCATCCAG |
TCTCAACAGAAAGGAGGCCCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 5, 1: 54, 2: 137, 3: 274, 4: 515} |
{0: 1, 1: 15, 2: 139, 3: 249, 4: 440} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|