ID: 946200796_946200813

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 946200796 946200813
Species Human (GRCh38) Human (GRCh38)
Location 2:218069701-218069723 2:218069752-218069774
Sequence CCCTCCACTGTGTCCCACTGCTG ACAGCCACAGCCCGGGAGGCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 43, 4: 463} {0: 1, 1: 1, 2: 4, 3: 43, 4: 412}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!