ID: 946201638_946201648

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 946201638 946201648
Species Human (GRCh38) Human (GRCh38)
Location 2:218073965-218073987 2:218073996-218074018
Sequence CCCCCTCCGAGTGTACAGAGAGC TACAGGACAGACAGAGCAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 82} {0: 1, 1: 1, 2: 8, 3: 82, 4: 404}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!